The Prime Temporal Point

[TimeTravelActivist]

Persephone,
<<How about a time signature, like in music, a particular language of music making a particular "vibration". Thus enabling, through this frequency, a process to occur?>>

Careful who your proposing this theory to, having numbers linked to anything pertaining to time travel and the future of humanity is not a very popular one on this thread /ttiforum/images/graemlins/smile.gif. Though valid, I feel that it’s contrary the consensus belief of God, and will not be fully taken in as something to consider as that possibility.

-TTA

 

[destroyingangel]

javier aka tta

The caped crusader comes to the rescue of the thread. What a joke you are. Should we all abandon mathematics because of your idiotic double-digit nonsense. We need to be careful of what we SAY? Because you say it? Ha Ha Ha Ha And what will you do? Report us to the double-digit temporal manipulators? Or maybe you'll get your buddy creedo to get one of his aliens after us. What makes you the defender of the concensus believers of God. He is just another manipulator to you. Where do you come up with all this crap? When you start making threats to others on this forum, perhaps the moderator should start thinking twice about allowing YOU on here. You've been kicked off others according to past posts. Even some sick accusations were alluded to YOU. Obviously, the poster Cat finds you very distasteful over some kind of betrayal. Perhaps YOU should be a bit more careful! WHAT A JOKE YOU ARE.

 

[TimeTravelActivist]

DestroyingAngel,
<<Should we all abandon mathematics because of your idiotic double-digit nonsense. We need to be careful of what we SAY?>>

Actually what I was saying, was that some of the fanatical individuals like you would not be capable of seeing any other side to numbers, but it all just being from God.

Anything else to that, is just your insecurity and immaturity talking /ttiforum/images/graemlins/smile.gif.

<<And what will you do? Report us to the double-digit temporal manipulators? Or maybe you'll get your buddy creedo to get one of his aliens after us. >>

What leads you to assume I would do anything, paranoid aren’t we

?

And Creedo is not my buddy.

<<What makes you the defender of the concensus believers of God. He is just another manipulator to you>>

I believe in God, I don’t believe in Time Travel. They are not 1 in the same, Time Travel deceives man to think that it will make you like God. I am just here to set the record straight, that’s all.

<<Where do you come up with all this crap? When you start making threats to others on this forum, perhaps the moderator should start thinking twice about allowing YOU on here. You've been kicked off others according to past posts>>

Perhaps he should think twice about not allowing you to post here. Your not exactly the most pleasing and open person to speak with /ttiforum/images/graemlins/smile.gif.

<< Even some sick accusations were alluded to YOU. Obviously, the poster Cat finds you very distasteful over some kind of betrayal.>>

Yes I know. And that’s to bad. In time she may realize the truth, and that’s all I can really hope for.

<< WHAT A JOKE YOU ARE.>>

Well, I’m glad I am making you laugh, since I am a joke to you

I can really tell your belly is going to blow wide open with all that hostility and anger you building up.

-TTA

 

[CAT]

Re: Musical Genome...

Hi Personphone,

You posted: <<How about a time signature, like in music, a particular language of music making a particular "vibration". Thus enabling, through this frequency process to occur?>>

Yes as a matter of fact something I have discovered (Which is very Biblical!) is indeed a MUSICAL SONG! IT'S THE HUMAN GENOME!

(I DONT KNOW IF YOU SAW THIS, BUT THIS IS THE POST I POSTED TO TRANSIENT.)
This is what I have learned from the Sefer Yetzirah regarding creation. First let me apply what I have learned that science teaches first. Let me start out with the four bases: A,T,C and
G spin out patters of chemical recipes for the creation of life!

The phosphates and sugars from the twisted frames of the stairs and the bases of the DNA
Helix (A,T,C,G, compounds) from the steps. Each step is made up of two bases (two letters of the
four letters, A,T,C, and G) and these two letters, (compounds) are joined in the middle. But it is not
a random pairing. Adenine (A), is ALWAYS joined with Thymine (T), to form a step in the spiral
ladder, or staircase. And Guanine (G) is always joined with Cytosine (C), but the steps may follow
each other endlessly and in any order, such as: AT,GC,CG,TA,AT,GC,CG, etc. A single gene might be a
chunk of DNA stairway perhaps 2,000 steps long and geneticists now think that it is the order of these
steps, the arrangement of AT,TA,TA,AT,GC,CG,TA.

Now according to the Sefira Yetsira it tells us to weigh and transpose the Hebrew letters. Aleph
with each one and each one with Aleph. Bet with each one and each one with Bet. They repeat in a
cycle. Therefore, everything formed and everything spoken emenates in one name (YHVH)
Yahovah. Symbolizing what science has discovered as the 4 bases A,T,C,G. SO LETS GIVE CREDIT
TO A RELIGIOUS BOOK THAT WAS WRITTEN THOUSANDS OF YEARS AGO.
Its true origin unknown?

Now Persephone, if you assign musical notes to each of the A,T,C,G of the DNA Helix, the musical sequence of the human DNA and analyzed it through a computer, these are the notes you will get:

TCACCCaggcTggagtGCAGTGACATGATCTCAGCTCACTGCAGTCT CTGCCTCCTGGGTTCCAGCAATTCTTCTGCCTCAGCCTCCCAGG TAGCTGGGATTACAAGCATGTACCATTAC

This music was translated by a guy by the Todd Barton through the Smithsonian in Washington D.C. If you would like to hear this music just do a web search on Todd Barton. After you hear the music, you will understand..........................


CAT...

 

[Transient001]

Friend CAT

I have seen what you reported about the 10th Sephira song that has not been sung yet, well I have been contemplating this concept and this is what I conceived. Take the ten sephiroth, the 1st sephira will not be used because it exist in the realm of the Eternal, not the physical, verbal universe, but in Atziluth. The 2nd and the 3rd belong to the second world, that of Beri´iah so too here music is not manifested, however on the third world, that of yetzirah it is where the choral of angels reside, they are the ones who honarably and most graciously will entone the sacred song of the 10th sephira. If you count the remaining sephira, they are seven, one for each musical note. Now if you extrapolate every single sephira with each other you will get something like this, 4-5-6-7-1-2-3; 5-6-7-1-2-3-4; 6-7-1-2-3-4-5;7-1-2-3-4-5-6; 1-2-3-4-5-6-7;2-3-4-5-6-7-1; 3-4-5-6-7-1-2. This is the firts part by continuing you will get 5-6-7-1-2-3-4, then 6-7-1-2-3-4-5....and so on until you complete the entire sequence. Now turn those numbers into musical notes and you will have the song of the 10th sephira. Now what we need to find out is if by resonating to this song we can actually tap into some sort of energy, be it of any kind.
About the chornotron field what you explain is very similar to what I have been told, except that in their example they did not create a bubble but actually a passage whose frequencies corresponds to the destination in time. It is very similar to what Persephone said previously, I explain.
Every single moment in time, as the chronotrons begin to accumulate, resonates with a particular intensity. If one could match up the chronotronic array of a particular time period and then align a time phasing portal to this array one would be in effect phasing to the destinated temporal period. As some view it the more chronotronic energy is placed in a quantum reality the more advanced in time the traveler would be. The more chronotronic energy is removed from a quantum reality the farther back in time the traveler would be.
Some realities, given to its peculiarities, accrue chronotrons faster than other ones. In others the accumulation is slower. The important thing is, then, to identify the rate of chronotronic accumulation in order to properly plot a temporal travel to the future or the past.
Until later becomes now.

 

[Persephone]

Re: Musical Genome...

Wow! Yes, this is the line of thinking, multi-dimensionally, that is right on the nose of the creative and intuitive capabilities of mankind. The human genome might infact have some incoded "symphony" of discovery and insight, even more so than the scientists and doctors are expecting. (think Star Trek Next Gen episode where each planet had a little piece of the puzzle in their basic genome. And ultimately, the originators unveiled their grand designs).

Being not neccesarily Christian, yet raised as such, I am wondering about all of the biblical references? Why do you think this collection of ancient documents holds more of the truth, or insights than others? What about other ancient writings and oral mythology? Why do you think there is something there? Is it God-derivative? Like a puzzle given to mankind to figure out when they are ready? What about the billions of folk on the planet who are not of the judeo-christian faith? Do they have their own wisdom handed down?

Just currious. I have studied religion in a few college courses, and have always found it very fascinating and totally historically relevant. But I must admit, I never thought to look there for insights in scientific credo or for insight into the physics of the universe.

Though of course this is a lame excuse. Our culture is so heavily pervasive in judeo-christian law and belief systems, it would be ignorant of me to ignore the influence.

And. I remain with an open mind. I have no problem courting the suggestions that ancient peoples had wisdoms that they recorded, wisdoms that we now grasp at through the lense of scientific eyes. More intuitive knowledge. I have found that to be true in areas of homeopathy (herbs) and such. And definitely, the older civilizations were closer to a way of living that was spiritual and nearer to the earth's ways.

Sometimes I think the bible was written in reverse, a thought I got from a book entitled "Venus on the Half Shell", a scifi novel written or at least credited to Kilgor Trout, which rumour has acknowledged as being a pen name for Kurt Vonnegut Jr.

In that mode, I see humanity as being in a larvae stage. With some fantastic "evolution" that is soon to occur. Like Adam and Eve in Eden, a new beginning, the start of humankind's adolescence. A stage that possibly is of energy and thought and responsibility.

And quite possibly, some people alive and with us today have been contacted by beings from this stage????

Anyone out there think they have been contacted by enlightened beings?

Persephone /ttiforum/images/graemlins/smile.gif

 

[Transient001]

Re: One culture\'s religion is another\'s science

Friend Persephone

Sorry for not havong answered so promptly, but yes you are right, the human genome is nothing more than the biocodes for ourspecies, and inlaid in those double helix of ours are secrets beyond our wildest dream. Those are the blueprints for the creation of life, flesh and blood beings not just machines. However keep in mind that both flesh and machine are made out of the same elementary substance, atomic structures. When lifekind learns how to effectively understand that concept we will truly learn the meaning of LIFE.

About the biblical references, the knowledge that our ancestors had was profoundly scientific, so profound, deep and complicated that they made a religion out of it. Through the millenia the basic scientific knowledge was eliminated and all that really remained was dogma. That is why the religions on our world are all very similar, one egg, one voice, one mother insiminated with the divine, one messenger, death and resurrection. It is present in the hindu culture, the greek's, the roman's, the babylonian's, the egyptian's, in most every single one of them.

Then by the middle ages some proto scientist figured this out, and they assembled it in what we know to be mysticism, magic or kabbalah. That is why it is so important to keep an eye on science but always remembering that these sacred texts can provide great advice and most possibly even work as our guides into re-discovery.

You posted "I see humanity as being in a larvae stage. With some fantastic "evolution" that is soon to occur" I completely concurr with you. Humanity IS growing, and it is growing into something so wonderful and fascinating that makes our detractors worry, they never thought we would have evolve as we have. That is amazing, and to know that there is further space for improvement makes me proud of this our race. But we should keep working together, as one single pulse, not loosing our individuality but being really aware of the needs of the others. By so doing we will some day, despite all of what the detractors think, be a wonderful race full of light.

I do not deny that many of Earth's residents are being contacted this very instant by beings of light, I in fact endorse it, for those are the human individuals that will help shape our future timeline. For if there is no guidence how are we suppose to cross the perilous river that stands ahead of us?

We have reached a point where our choices can destroy, and have destroyed, entire cities, polluted entire oceans, destroyed the ozone layer possibly beyond repair and caused this planet to overheat resulting in crazed weather patters. We stand at a point where the repercussions of our choices are no longer small, they have become global scale uncorrectable mistakes. We can not even solve our own problems talking, no. We threathen to deliver the BOMB over our houses if a nation does not yields to our desires, even asking the UN to either condone the action or to move aside. This demonstrate that we are bordering on anarchy, no longer following global institutionary laws.

So I welcome you beings of light, where ever you are. Come and help us, for I have seen one too many worlds go down the road of perdition and I do not want to see the one where I reside go that path too.

Until later becomes now.

 

[Transient001]

Re: One culture\'s religion is another\'s science

Friend Persephone

Sorry for not having answered so promptly, but yes you are right, the human genome is nothing more than the biocodes for ourspecies, and inlaid in those double helix of ours are secrets beyond our wildest dream. Those are the blueprints for the creation of life, flesh and blood beings not just machines. However keep in mind that both flesh and machine are made out of the same elementary substance, atomic structures. When lifekind learns how to effectively understand that concept we will truly learn the meaning of LIFE.

About the biblical references, the knowledge that our ancestors had was profoundly scientific, so profound, deep and complicated that they made a religion out of it. Through the millenia the basic scientific knowledge was eliminated and all that really remained was dogma. That is why the religions on our world are all very similar, one egg, one voice, one mother insiminated with the divine, one messenger, death and resurrection. It is present in the hindu culture, the greek's, the roman's, the babylonian's, the egyptian's, in most every single one of them.

Then by the middle ages some proto scientist figured this out, and they assembled it in what we know to be mysticism, magic or kabbalah. That is why it is so important to keep an eye on science but always remembering that these sacred texts can provide great advice and most possibly even work as our guides into re-discovery.

You posted "I see humanity as being in a larvae stage. With some fantastic "evolution" that is soon to occur" I completely concurr with you. Humanity IS growing, and it is growing into something so wonderful and fascinating that makes our detractors worry, they never thought we would have evolve as we have. That is amazing, and to know that there is further space for improvement makes me proud of this our race. But we should keep working together, as one single pulse, not loosing our individuality but being really aware of the needs of the others. By so doing we will some day, despite all of what the detractors think, be a wonderful race full of light.

I do not deny that many of Earth's residents are being contacted this very instant by beings of light, I in fact endorse it, for those are the human individuals that will help shape our future timeline. For if there is no guidence how are we suppose to cross the perilous river that stands ahead of us?

We have reached a point where our choices can destroy, and have destroyed, entire cities, polluted entire oceans, destroyed the ozone layer possibly beyond repair and caused this planet to overheat resulting in crazed weather patters. We stand at a point where the repercussions of our choices are no longer small, they have become global scale uncorrectable mistakes. We can not even solve our own problems talking, no. We threathen to deliver the BOMB over our houses if a nation does not yields to our desires, even asking the UN to either condone the action or to move aside. This demonstrate that we are bordering on anarchy, no longer following global institutionary laws.

So I welcome you beings of light, where ever you are. Come and help us, for I have seen one too many worlds go down the road of perdition and I do not want to see the one where I reside go that path too.

Until later becomes now.

 

[Persephone]

Re: One culture\'s religion is another\'s science

Dear Friend Transient,

Do not worry thus about the delay, we will find time as needed.

You speak (write) as though you have seen much. And the nature of the title that you give yourself, implies you are "well-travelled". I am curious to learn more, in detail, even if you think it might sound preposterous, what of these "other worlds"?

My curiousity bespeaks my nature, but can you divulge more of this?

We are most definitely of the same mindset in regards to the present condition of humanity and the world in which we reside . But you seem to have a definitive confidence about these matters of which I merely seem to have a lingering memory or glimpse.

And what of "the beings of light" of which you speak? Have you seen them? Have you communicated? Would you think I am crazy if I said I may have communicated with "them"? Maybe I am just pulling your leg, or maybe I am not....

All I know is that I have had experiences that I can not explain entirely within the terms of present scientific knowledge.

I feel quite vulnerable stating that. I am a skeptic by nature. With a soul that longs for meaning and order or logic. So all you readers out there, please don't disregard me as a flake. Please keep an open mind.

So, I guess what I am truly asking is for details. Maybe through some sort of discourse I can find similarities beyond our positions and belief structure, that might validate my experiences.

"The appropriateness of chance is astounding"

Persephone

 

[Persephone]

Referring to some of the "mechanical" discussion concerning the "Prime Temporal Point" and phasing, this phrase "About the chornotron field what you explain is very similar to what I have been told, except that in their example they did not create a bubble but actually a passage whose frequencies corresponds to the destination in time".

In actuality, I think that a "bubble" is what first occurs. It is very difficult to maintain. Then, if the flux is flowing correctly or positively, the whole shape of it becomes a "donut" shaped vortex, sort of like a slipstream, stationary, a recycling energy maneuver. I hope this description is statisfactory, because I can picture it in my head, and would rather draw it for you then try to describe it. Then, this "donut" of imploding/exploding energy would begin to "move" in a spiral fashion, on the energy that glues the universe together, pushing one bit of "mysterious matter" out of the way and catching onto the gravitational pull of the next bit of "mysterious matter".

This is how I see it.

The mysterious matter could be dark matter or dark energy, or whatever the scientists are calling it these days.

The key is to plot a trajectory, of sorts, knowing the spiral configuration, and drag of nearby objects. Slingshot-like, if you will, using the pull of the energy of time/space. Very, very tricky. A time signature of the target is most important, but not neccesarily fool proof, lots of variables.

Oh, silly me. Is it possible to time travel? Is it possible to survive? Is it possible to tap into a universe of energy. Let's just hope so, and leave it at that.

"The appropriateness of chance is astounding"

Persephone

 

[Transient001]

Re: One culture\'s religion is another\'s science

Friend Persephone

Yes there are many variations of Earth, however the most beautiful ones are those that correspond to this planet but do ot resemble it. For example ther is one of this World, EarthTR045.8563, where human life never came to be. This world, which was a lush nearly paradisiacal planet, develop little by little into a precious green jewel. However the most interesting thing was that 13th centuries ago a race of beings took shelter on this version of Earth. But they kept it as the world they found nearly thirteen hundred years ago. This is remarckable.

I told TTA that I was going to check on my files to see which observations of these worlds are more apt to be shown.

"We are most definitely of the same mindset in regards to the present condition of humanity and the world in which we reside . But you seem to have a definitive confidence about these matters of which I merely seem to have a lingering memory or glimpse."

Yes Persephone, we definitely are. Regarding the my confidence, well, I have faith in humanity, thus I trust humanity will reach someday the goals we have spoken of here in this forum.

"And what of "the beings of light" of which you speak? Have you seen them? Have you communicated? Would you think I am crazy if I said I may have communicated with "them"

Well I have seen several things which could be classified in the fiction part of the library.

"I feel quite vulnerable stating that"

Do not feel like that. Those are feelings of a sensible person, I respect that.

I will work on posting some of my observations.

Until later becomes now.

 

[Transient001]

Re: The PTP rescued

Friend TelJaninAensilar

Since you rather prefer the more kabbalistic approach to the temporal realm, I suggest you first get acquainted with the notions of the sephiroth. The paths in the Tree Of Life, the relevance of each sephirotic attribute, the main idea behind quantum physics, a notion of what wormholes are and something of the gematria and notariqons of ancient hebrews.

Of most of this we have talkied about in this topic. If you have any question please feel free to ask CAT, DA or me. Creedo could help you too, but his expertize is in intergalaxian affairs. Frog is also knowledgeable in the time travel/transmaterialization issues and finally our dear friend Persephone how is the most scientifical poet I have ever met. I am sure we could all help.

In a nut shell...

The PTP is as we have defined a point, in fact the first point, outside the boundaries of creation. It exist in a realm of awareness higher than the one we currently find ourselves. It can be experienced through a meditation in which the observer surrounds herself/himself with the power of the eight sephirots and Daath as a lifeline/temporal line that reaches forth to the PTP. It is through the employment of this spiritual lifeline that the observer can reach the PTP. From here the myriad worlds and time frames can easily be looked at by the timephaser as an inertial observer.

If you have any question, please do not hesitate to ask, we can help you here.

Until later becomes now.

 

[Doggie186]

Re: The PTP rescued

Transient001
Hi transient it's frog I changed my id to doggie186 now thanks for for comments and thanks for everything the advice, info, tips, and so much more so what have you been up too lately? I have been busy doing research and other things in general I have two questions to ask you here they are do wormholes and blackholes exist where your from? two what is time like where your from is it the same as our time or very different? well I hope you have a good day and wish you great luck in what your doing and I hope we can talk again later on I am a honest person so I will never lie at all well I must be going now good luck in what your doing well see ya later!